p35S:RUBY 5’ CYSTM α
(Plasmid
#247493)
-
PurposePlasmid p35S:RUBY 5’ CYSTM α contains a 79-nt 5′ CYSTM α sequence placed directly upstream of the CYP76AD1 coding region (first gene in the RUBY cassette), intended to boost translation efficiency
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAMBIA
- Backbone size w/o insert (bp) 14340
- Total vector size (bp) 14420
-
Vector typeBacterial Expression, Plant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5′ CYSTM α (From the 5' UTR of CYSTM1 gene)
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)79
-
GenBank IDAT1G05340
- Promoter CaMV 35S
-
Tag
/ Fusion Protein
- n/a (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer TATCCTTCGCAAGACCCTTC
- 3′ sequencing primer GCTTTGGTCCTGGCGGAAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.10.15.682649 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35S:RUBY 5’ CYSTM α was a gift from Iain Searle (Addgene plasmid # 247493 ; http://n2t.net/addgene:247493 ; RRID:Addgene_247493) -
For your References section:
The Arabidopsis CYSTM alpha 5' UTR Increases Protein Production from Transgenes in Plants and Bacteria. Khanduja JS, Wu X, Li J, Searle IR. Genes (Basel). 2026 Apr 28;17(5):520. doi: 10.3390/genes17050520. 10.3390/genes17050520 PubMed 42194977