Skip to main content

DJ-L1 gRNA #1
(Plasmid #247542)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247542 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-U6-sgRNA-EGFP
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting human L1DJ
  • gRNA/shRNA sequence
    CTTGCTTAACTGTTAAAGGG
  • Species
    H. sapiens (human)
  • Mutation
    none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DJ-L1 gRNA #1 was a gift from Miguel Ramalho-Santos (Addgene plasmid # 247542 ; http://n2t.net/addgene:247542 ; RRID:Addgene_247542)
  • For your References section:

    LINE1 elements at distal junctions of rDNA repeats regulate nucleolar organization in human embryonic stem cells. Ataei L, Zhang J, Monis S, Giemza K, Mittal K, Yang J, Shimomura M, McStay B, Wilson MD, Ramalho-Santos M. Genes Dev. 2025 Feb 3;39(3-4):280-298. doi: 10.1101/gad.351979.124. 10.1101/gad.351979.124 PubMed 39797762