rDNA-adj gRNA #1
(Plasmid
#247548)
-
Purposenegative control for Crispri KD
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3-U6-sgRNA-EGFP
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenegative control sgRNA targeting region adjacent to 5' end of ribosomal DNA repeats of distal junction
-
gRNA/shRNA sequenceCATTTGAGACTTTCTGTAAG
-
SpeciesH. sapiens (human)
-
Mutationnone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rDNA-adj gRNA #1 was a gift from Miguel Ramalho-Santos (Addgene plasmid # 247548 ; http://n2t.net/addgene:247548 ; RRID:Addgene_247548) -
For your References section:
LINE1 elements at distal junctions of rDNA repeats regulate nucleolar organization in human embryonic stem cells. Ataei L, Zhang J, Monis S, Giemza K, Mittal K, Yang J, Shimomura M, McStay B, Wilson MD, Ramalho-Santos M. Genes Dev. 2025 Feb 3;39(3-4):280-298. doi: 10.1101/gad.351979.124. 10.1101/gad.351979.124 PubMed 39797762