Skip to main content

pFunnyfarm
(Plasmid #24755)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24755 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAsylum
  • Backbone manufacturer
    Christopher Buck lab, Addgene plasmid 24754
  • Backbone size w/o insert (bp) 1851
  • Vector type
    Gateway-adapted entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Bleocin (Zeocin), 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    ccdB survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAT-ccdB cassette
  • Species
    N/A
  • Insert Size (bp)
    2497

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer M13/pUC Forward
  • 3′ sequencing primer AsyR (CTGAAAGAGGAACTTGGTTAGG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFunnyfarm was a gift from Christopher Buck (Addgene plasmid # 24755 ; http://n2t.net/addgene:24755 ; RRID:Addgene_24755)
  • For your References section:

    Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB.. Cell Host Microbe. 2010 Jun 25;7(6):509-15. 10.1016/j.chom.2010.05.006 PubMed 20542254