pTKI-Tyr
(Plasmid
#247647)
-
PurposeExpresses GFP-SUMO-Tyr-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepTKI
- Backbone size w/o insert (bp) 5023
- Total vector size (bp) 6852
-
Modifications to backboneAssembled by Gibson Assembly from ColE1, TetR, L5 integrase, and KanR fragments from PLJR962 (Addgene plasmid #115162)
-
Vector typeBacterial Expression ; Mycobacterial integrating
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions50 ug/uL Kan in E. coli; 20 ug/uL Kan in M. smegmatis
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-SUMO-Tyr-mCherry N-degron proteolysis dual-fluorescence reporter
-
SpeciesSynthetic
-
Insert Size (bp)1815
- Promoter PTet
-
Tags
/ Fusion Proteins
- HA tag (N terminal on insert)
- Myc tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pTKI_seq_F (TTACGCTGACTTGACGGGAC)
- 3′ sequencing primer pTKI_seq_R (GGACAGGTATCCGGTAAGCG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTKI-Tyr was a gift from Karl Schmitz (Addgene plasmid # 247647 ; http://n2t.net/addgene:247647 ; RRID:Addgene_247647) -
For your References section:
ClpS Directs Degradation of N-Degron Substrates With Primary Destabilizing Residues in Mycolicibacterium smegmatis. Presloid CJ, Jiang J, Kandel P, Anderson HR, Beardslee PC, Swayne TM, Schmitz KR. Mol Microbiol. 2025 Jan;123(1):16-30. doi: 10.1111/mmi.15334. Epub 2024 Dec 3. 10.1111/mmi.15334 PubMed 39626090