pTKIU-Ser
(Plasmid #247650)

• Purpose: Expresses GFP-SUMO-Ser-mCherry N-degron reporter driven by aTc responsive promoter, and constitutively expresses Ulp1, from KanR integrating mycobacterial plasmid
• Depositing Lab: Karl Schmitz
• Publication: Presloid et al Mol Microbiol. 2025 Jan;123(1):16-30. doi: 10.1111/mmi.15334. Epub 2024 Dec 3.

Backbone

• Vector backbone: pTKI
• Backbone size w/o insert (bp): 5023
• Total vector size (bp): 7732
• Modifications to backbone: Assembled by Gibson Assembly from ColE1, TetR, L5 integrase, and KanR fragments from PLJR962 (Addgene plasmid #115162)
• Vector type: Bacterial Expression ; Mycobacterial integrating

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 50 ug/uL Kan in E. coli; 20 ug/uL Kan in M. smegmatis
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: GFP-SUMO-Ser-mCherry N-degron proteolysis dual-fluorescence reporter
• Species: Synthetic
• Insert Size (bp): 1815
• Promoter: PTet
• Tags / Fusion Proteins:
  • HA tag (N terminal on insert)
  • Myc tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pTKI_seq_F (TTACGCTGACTTGACGGGAC)
• 3′ sequencing primer: pTKI_seq_R (GGACAGGTATCCGGTAAGCG)

Gene/Insert 2

• Gene/Insert name: Ulp1 SUMO protease
• Species: Chaetomium thermophilum
• Insert Size (bp): 860
• Promoter: PTet (co-operonic with GFP-SUMO-Ser-mCherry)
• Tag / Fusion Protein:
  • 3xFLAG tag (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pTKI_seq_F (TTACGCTGACTTGACGGGAC)
• 3′ sequencing primer: pTKI_seq_R (GGACAGGTATCCGGTAAGCG)

Resource Information

• Supplemental Documents:
  • pTKIU-Ser_GFP-SUMO-Ser-mCherry_Ulp1.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA