Lentivirus ABE8e-V106W with non-targeting sgRNA
(Plasmid
#247668)
-
PurposeLentivirus genome encoding ABE8eV106W editor and Sp sgRNA cassette non-targeting control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPRv2
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABE8e-V106W and non-targeting sgRNA
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lentivirus ABE8e-V106W with non-targeting sgRNA was a gift from David Liu (Addgene plasmid # 247668 ; http://n2t.net/addgene:247668 ; RRID:Addgene_247668) -
For your References section:
In vivo base editing rescues liver pathophysiology and peroxisome dysfunction in a mouse model of Zellweger spectrum disorder. Gao XD, Presa M, Duby JE, Ryan J, Piec P-A, Hsu A, Banskota S, Jiang AY, Chen L, Newby GA, Di Pietro E, Levy JM, Steele BH, Lecordier S, Qin F, Moser AB, Xie J, Gao G, Braverman NE, Zuberi AR, Hacia JG, Lutz CM, Liu DR. Nat. Biomed. Eng (2026). https://doi.org/10.1038/s41551-026-01651-5 10.1038/s41551-026-01651-5