pBK-EcTyrRS-VSMA
(Plasmid
#247683)
-
PurposeExpressed E. coli tyrosyl synthetase for multiplexed BONCAT bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBK
- Backbone size w/o insert (bp) 1974
- Total vector size (bp) 3249
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE. coli tyrosyl tRNA synthetase VSMA mutant
-
Alt nameEcYRS
-
SpeciesE. coli
-
Insert Size (bp)1275
- Promoter glnS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer gtcccgcttataagatcatacgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBK-EcTyrRS-VSMA was a gift from Abhishek Chatterjee (Addgene plasmid # 247683 ; http://n2t.net/addgene:247683 ; RRID:Addgene_247683) -
For your References section:
Cell-selective multiplexed bioorthogonal noncanonical amino acid tagging for nascent proteomics. Loynd C, Singha Roy SJ, Canarelli SE, Bak DW, Sundaresh B, Babbitz Z, van Opijnen T, Weerapana E, Chatterjee A. Nat Chem Biol. 2025 Oct 2. doi: 10.1038/s41589-025-02039-3. 10.1038/s41589-025-02039-3 PubMed 41039161