Skip to main content

pBK-EcTyrRS-VSMA
(Plasmid #247683)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247683 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBK
  • Backbone size w/o insert (bp) 1974
  • Total vector size (bp) 3249
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E. coli tyrosyl tRNA synthetase VSMA mutant
  • Alt name
    EcYRS
  • Species
    E. coli
  • Insert Size (bp)
    1275
  • Promoter glnS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer gtcccgcttataagatcatacgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBK-EcTyrRS-VSMA was a gift from Abhishek Chatterjee (Addgene plasmid # 247683 ; http://n2t.net/addgene:247683 ; RRID:Addgene_247683)
  • For your References section:

    Cell-selective multiplexed bioorthogonal noncanonical amino acid tagging for nascent proteomics. Loynd C, Singha Roy SJ, Canarelli SE, Bak DW, Sundaresh B, Babbitz Z, van Opijnen T, Weerapana E, Chatterjee A. Nat Chem Biol. 2025 Oct 2. doi: 10.1038/s41589-025-02039-3. 10.1038/s41589-025-02039-3 PubMed 41039161