anti-FLAG-CAR (human, optimised, tonic-signal-free)
(Plasmid
#247778)
-
PurposeAnti-FLAG scFv with Myc-tag, human CD8α-truncated hinge, and human CD28-CD3z intracellular domain.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247778 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-mPLUM
- Backbone size w/o insert (bp) 7729
- Total vector size (bp) 9328
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersmPLUM
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameantiFLAG-CAR4
-
SpeciesSynthetic
-
Insert Size (bp)1507
- Promoter EF-1α
-
Tag
/ Fusion Protein
- Myc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAAGTTTAAAGCTCAGGTCGAGACCGG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
anti-FLAG-CAR (human, optimised, tonic-signal-free) was a gift from Clare Slaney (Addgene plasmid # 247778 ; http://n2t.net/addgene:247778 ; RRID:Addgene_247778) -
For your References section:
Optimised modular anti-FLAG CAR T cells for solid tumor therapy. Zhang X, Xu R, Zorin D, Pappas EG, Tang J, Bai Y, Qin VM, von Scheidt B, Huang R, Kulakowska W, Darido C, Darcy PK, Kershaw MH, Slaney CY. Clin Transl Immunology. 2025 Aug 21;14(8):e70046. doi: 10.1002/cti2.70046. eCollection 2025. 10.1002/cti2.70046 PubMed 40851786