Skip to main content

pAAV-CMVenh synapsin-intron-aSYNUCLEIN WT
(Plasmid #247940)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247940 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Wilson
  • Backbone size w/o insert (bp) 4975
  • Total vector size (bp) 5398
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    alpha synuclein WT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    422
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter CMVenh synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GGTTACAAGACAGGTTTAAGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMVenh synapsin-intron-aSYNUCLEIN WT was a gift from Veerle Baekelandt (Addgene plasmid # 247940 ; http://n2t.net/addgene:247940 ; RRID:Addgene_247940)
  • For your References section:

    rAAV2/7 vector-mediated overexpression of alpha-synuclein in mouse substantia nigra induces protein aggregation and progressive dose-dependent neurodegeneration. Oliveras-Salva M, Van der Perren A, Casadei N, Stroobants S, Nuber S, D'Hooge R, Van den Haute C, Baekelandt V. Mol Neurodegener. 2013 Nov 25;8:44. doi: 10.1186/1750-1326-8-44. 10.1186/1750-1326-8-44 PubMed 24267638