pAAV-CMVenh synapsin-intron-aSYNUCLEIN WT
(Plasmid
#247940)
-
PurposeAAV transfer plasmid encoding the human α-SYN under the control of the CMVie enhanced synapsin1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerWilson
- Backbone size w/o insert (bp) 4975
- Total vector size (bp) 5398
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namealpha synuclein WT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)422
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter CMVenh synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer GGTTACAAGACAGGTTTAAGGAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMVenh synapsin-intron-aSYNUCLEIN WT was a gift from Veerle Baekelandt (Addgene plasmid # 247940 ; http://n2t.net/addgene:247940 ; RRID:Addgene_247940) -
For your References section:
rAAV2/7 vector-mediated overexpression of alpha-synuclein in mouse substantia nigra induces protein aggregation and progressive dose-dependent neurodegeneration. Oliveras-Salva M, Van der Perren A, Casadei N, Stroobants S, Nuber S, D'Hooge R, Van den Haute C, Baekelandt V. Mol Neurodegener. 2013 Nov 25;8:44. doi: 10.1186/1750-1326-8-44. 10.1186/1750-1326-8-44 PubMed 24267638