V5-BS2-ELLVAT-NLS
(Plasmid
#247992)
-
PurposeBS2-ELLVAT mammalian expression plasmid (nuclear localization sequence)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboned0
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBS2-ELLVAT Esterase
-
SpeciesBacillus subtilis
-
Insert Size (bp)1566
- Promoter CMV
-
Tags
/ Fusion Proteins
- V5 Tag (N terminal on insert)
- NLS (Nuclear Localization Sequence) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.26434/chemrxiv-2025-d6bzr for ChemRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V5-BS2-ELLVAT-NLS was a gift from Jeffrey Martell (Addgene plasmid # 247992 ; http://n2t.net/addgene:247992 ; RRID:Addgene_247992) -
For your References section:
Directed Evolution of Enzymes for Bioorthogonal Chemistry Using Acid Chloride Proximity Labeling. Ogorek AN, Pani S, Mertick-Sykes EJ, Momirov J, Lao Y, Mejia FB, Chan RST, Huang X, Dickinson BC, Martell JD. ACS Cent. Sci. 2026, 10.1021/acscentsci.5c01746