Skip to main content
Addgene
Open Menu

pGIPZ EF1a myc tagged mbIL15 IRES miRFP720-P2A-Blast
(Plasmid #248032)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248032 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pGIPZ
  • Backbone size w/o insert (bp) 12121
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin ; and miRFP720

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    myc-tagged membrane bound IL15
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1240
  • Entrez Gene
    IL15 (a.k.a. IL-15)
  • Promoter human EF1a
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer atagaagaGaAcgggaccg
  • 3′ sequencing primer cctcacattgccaaaagacg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Laurence Cooper (IL15 construct originally developed by Hurton et al., 2016; PMID 27849617)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Membrane bound IL15 construct: IgE signal peptide - IL15 - linker - IL15Ra - Myc.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGIPZ EF1a myc tagged mbIL15 IRES miRFP720-P2A-Blast was a gift from Joshua Leonard (Addgene plasmid # 248032 ; http://n2t.net/addgene:248032 ; RRID:Addgene_248032)

  • For your References section:

    Comparative Evaluation of Synthetic Cytokines for Enhancing Production and Performance of NK92 Cell-Based Therapies. Deol S, Donahue PS, Mitrut RE, Hammitt-Kess IJ, Ahn J, Zhang B, Leonard JN. GEN Biotechnol. 2023 Jun 1;2(3):228-246. doi: 10.1089/genbio.2023.0024. Epub 2023 Jun 19. 10.1089/genbio.2023.0024 PubMed 37363412
Related items: