CAG-mKate2-NLS
(Plasmid
#248044)
-
PurposeEncodes nuclear mKate2 fluorescent protein, under control of the CAG promoter. The construct is flanked by Tol2 sites for transgenesis.
-
Depositing Lab
-
Depositing OrganizationUniversite Claude Bernard Lyon 1
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTol2
- Backbone size w/o insert (bp) 2999
- Total vector size (bp) 5909
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemKate2-NLS
-
Insert Size (bp)723
-
MutationmKate2 was derived from mKate with the following mutations: M1_S2insV/V45A/M146T/S158A/K231R
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CM O 069 seq CAGGS end F : GGGCAACGTGCTGGTTATTGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-mKate2-NLS was a gift from Christophe Marcelle (Addgene plasmid # 248044 ; http://n2t.net/addgene:248044 ; RRID:Addgene_248044) -
For your References section:
TEADlight, a bright dynamic reporter for live detection of YAP/TAZ-TEAD signaling. Morin V, Le Toquin Y, Tepordei D, Marcelle C, Delaune E. Dev Biol. 2025 Sep;525:194-205. doi: 10.1016/j.ydbio.2025.06.007. Epub 2025 Jun 6. 10.1016/j.ydbio.2025.06.007 PubMed 40482695