CAG-YAP1∆TA
(Plasmid
#248048)
-
PurposeEncodes a YAP1 mutant lacking the transactivation domain, under the control of the CAG promoter. The construct is flanked by Tol2 sites for transgenesis.
-
Depositing Lab
-
Depositing OrganizationUniversite Claude Bernard Lyon 1
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTol2
- Backbone size w/o insert (bp) 2966
- Total vector size (bp) 6152
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYAP1
-
Alt nameYAP1-TA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)870
-
MutationTransactivationdomain deleted (aa291-497)
-
GenBank IDNM_001195044
-
Entrez GeneYAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
- Promoter Caggs
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CM O 069 seq CAGGS end F : GGGCAACGTGCTGGTTATTGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA portion of this plasmid was derived from : https://www.addgene.org/59143/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-YAP1∆TA was a gift from Christophe Marcelle (Addgene plasmid # 248048 ; http://n2t.net/addgene:248048 ; RRID:Addgene_248048) -
For your References section:
TEADlight, a bright dynamic reporter for live detection of YAP/TAZ-TEAD signaling. Morin V, Le Toquin Y, Tepordei D, Marcelle C, Delaune E. Dev Biol. 2025 Sep;525:194-205. doi: 10.1016/j.ydbio.2025.06.007. Epub 2025 Jun 6. 10.1016/j.ydbio.2025.06.007 PubMed 40482695