Halo-PINK1-SPARK S/A
(Plasmid
#248089)
-
PurposeHaloTag labeled PINK1-SPARK control construct with PINK1 phosphosite mutated
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Total vector size (bp) 7300
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHalo-PINK1-SPARK S/A
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal SPARK construct was developed by Xiaokun Shu's lab (Addgene #106920)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.10.08.681260 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-PINK1-SPARK S/A was a gift from Danielle Schmitt (Addgene plasmid # 248089 ; http://n2t.net/addgene:248089 ; RRID:Addgene_248089) -
For your References section:
Visualizing PINK1 Activity Dynamics in Single Cells with a Phase Separation-Based Kinase Activity Reporter. Vineall KG, Andrikopoulos A, Sun MJ, Yan A, Hartanto ER, Schmitt DL. ACS Sens. 2026 Feb 3:XXX. doi: 10.1021/acssensors.5c03859. 10.1021/acssensors.5c03859 PubMed 41632883