LNPL1093-piggybac-Dox-inducible-CasRx-QK634-UnirapR-IRES-mCherry
(Plasmid
#248111)
-
PurposeExpresses dox-inducible ChemoCas13d or CasRx-QK634-LightR (UnirapR domain inserted right after amino acid residue 634 of CasRx)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepiggybac
- Backbone size w/o insert (bp) 5646
- Total vector size (bp) 9234
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCasRx-UnirapR
-
Alt nameRfxCas13d-UnirapR
-
SpeciesSynthetic
-
Insert Size (bp)3588
- Promoter Tet inducible
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GATATCAACTAGAATGCTAGCATGGGCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector does not contain rTTA; therefore, the cell line needs to constitutively express rTTA for this system to work.
Please visit https://doi.org/10.1101/2025.04.21.649818 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LNPL1093-piggybac-Dox-inducible-CasRx-QK634-UnirapR-IRES-mCherry was a gift from Jared Toettcher (Addgene plasmid # 248111 ; http://n2t.net/addgene:248111 ; RRID:Addgene_248111) -
For your References section:
Multimodal control of Cas13 activity through domain insertion at an allosteric hotspot. Zhu L, Nguyen LT, Bell AG, Gillmann KM, Oatman H, Hariri J, Myhrvold C, Toettcher JE. bioRxiv 2025.04.21.649818 10.1101/2025.04.21.649818