pFUW-SNAP25B-R59P
(Plasmid
#248129)
-
PurposeMammalian expression lentiviral vector encoding the Synaptosomal-Associated Protein (SNAP-25) with R59P mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUW
- Backbone size w/o insert (bp) 9124
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNAP25B-R59P
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1206
-
MutationR59P
-
Entrez GeneSNAP25 (a.k.a. CMS18, RIC-4, RIC4, SEC9, SNAP, SNAP-25, SUP, bA416N4.2, dJ1068F16.2)
- Promoter Ubiquitin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ttgaaatgtaatcatttgggtc
- 3′ sequencing primer aggttgattatcgataagcttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. David Baltimore
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Human SNAP25B with a silent mutation at residue #3 GAA for GAG [E]
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUW-SNAP25B-R59P was a gift from Ege Kavalali (Addgene plasmid # 248129 ; http://n2t.net/addgene:248129 ; RRID:Addgene_248129) -
For your References section:
Role of Aberrant Spontaneous Neurotransmission in SNAP25-Associated Encephalopathies. Alten B, Zhou Q, Shin OH, Esquivies L, Lin PY, White KI, Sun R, Chung WK, Monteggia LM, Brunger AT, Kavalali ET. Neuron. 2021 Jan 6;109(1):59-72.e5. doi: 10.1016/j.neuron.2020.10.012. Epub 2020 Nov 3. 10.1016/j.neuron.2020.10.012 PubMed 33147442