Skip to main content

pFUW-SNAP25B-V48F
(Plasmid #248130)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248130 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUW
  • Backbone size w/o insert (bp) 9124
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SNAP25B-V48F
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1185
  • Mutation
    V48F
  • Entrez Gene
    SNAP25 (a.k.a. CMS18, DEE117, RIC-4, RIC4, SEC9, SNAP, SNAP-25, SUP, bA416N4.2, dJ1068F16.2)
  • Promoter Ubiquitin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ttgaaatgtaatcatttgggtc
  • 3′ sequencing primer aggttgattatcgataagcttg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. David Baltimore

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Human SNAP25B with a silent mutation at residue #3 GAA for GAG [E]

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-SNAP25B-V48F was a gift from Ege Kavalali (Addgene plasmid # 248130 ; http://n2t.net/addgene:248130 ; RRID:Addgene_248130)
  • For your References section:

    Role of Aberrant Spontaneous Neurotransmission in SNAP25-Associated Encephalopathies. Alten B, Zhou Q, Shin OH, Esquivies L, Lin PY, White KI, Sun R, Chung WK, Monteggia LM, Brunger AT, Kavalali ET. Neuron. 2021 Jan 6;109(1):59-72.e5. doi: 10.1016/j.neuron.2020.10.012. Epub 2020 Nov 3. 10.1016/j.neuron.2020.10.012 PubMed 33147442