Skip to main content

pFUW-Syb2-A67P
(Plasmid #248132)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248132 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUW
  • Backbone size w/o insert (bp) 9124
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Syb2-A67P
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1194
  • Mutation
    A67P
  • Entrez Gene
    Vamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
  • Promoter Ubiquitin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ttgaaatgtaatcatttgggtc
  • 3′ sequencing primer aggttgattatcgataagcttg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. David Baltimore

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-Syb2-A67P was a gift from Ege Kavalali (Addgene plasmid # 248132 ; http://n2t.net/addgene:248132 ; RRID:Addgene_248132)
  • For your References section:

    Synaptobrevin-2 disease variants reveal spatial constraints within the presynaptic active zone. Guzikowski NJ, Bagatelas ED, Shin OH, Khan YA, Esquivies L, Alten B, Brunger AT, Kavalali ET. Proc Natl Acad Sci U S A. 2025 Nov 4;122(44):e2507347122. doi: 10.1073/pnas.2507347122. Epub 2025 Oct 30. 10.1073/pnas.2507347122 PubMed 41166419