pFUW-Syb2-R56L
(Plasmid
#248136)
-
PurposeMammalian expression lentiviral vector encoding the wild-type Synaptobrevin2 (Syb2) with R56L mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUW
- Backbone size w/o insert (bp) 9124
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSyb2-R56L
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1161
-
MutationR56L
-
Entrez GeneVamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
- Promoter Ubiquitin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ttgaaatgtaatcatttgggtc
- 3′ sequencing primer aggttgattatcgataagcttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. David Baltimore
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUW-Syb2-R56L was a gift from Ege Kavalali (Addgene plasmid # 248136 ; http://n2t.net/addgene:248136 ; RRID:Addgene_248136) -
For your References section:
Synaptobrevin-2 disease variants reveal spatial constraints within the presynaptic active zone. Guzikowski NJ, Bagatelas ED, Shin OH, Khan YA, Esquivies L, Alten B, Brunger AT, Kavalali ET. Proc Natl Acad Sci U S A. 2025 Nov 4;122(44):e2507347122. doi: 10.1073/pnas.2507347122. Epub 2025 Oct 30. 10.1073/pnas.2507347122 PubMed 41166419