Skip to main content

pAvA139
(Plasmid #248145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248145 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCfB3035
  • Backbone size w/o insert (bp) 4405
  • Vector type
    Yeast Expression ; integration vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    luxR (gen1 mutations)
  • Species
    Vibrio fischeri
  • Insert Size (bp)
    1125
  • Mutation
    Gal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GTA→GTT), K114E. LuxR: N5D, V36 (GTT→GTC), N86I, S164Y, D182 (GAT→GAC)
  • Promoter pPGK1
  • Tags / Fusion Proteins
    • Gal4 activation domain
    • nuclear localization signal

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer gtacaggatacgctaattgc
  • 3′ sequencing primer acacgcctgttacttcttgc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Original coding sequence of luxR was derived from Addgene plasmid #165971, which we fused with Gal4_AD and subjected to mutagenesis and selected this variant.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.21203/rs.3.rs-6620198/v1 for Research Square preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAvA139 was a gift from Emil Jensen (Addgene plasmid # 248145 ; http://n2t.net/addgene:248145 ; RRID:Addgene_248145)
  • For your References section:

    Engineering N-acyl-homoserine lactone-based quorum-sensing circuit for dynamic regulatory control in Saccharomyces cerevisiae. van Aalst ACA, Holtz M, Lyskjaer Jensen M, Schroder T, Crocoll C, Poborsky M, Damgaard Jensen E, Krogh Jensen M. Commun Biol. 2025 Nov 27. doi: 10.1038/s42003-025-09163-9. 10.1038/s42003-025-09163-9 PubMed 41310402