pAvA143
(Plasmid
#248147)
-
Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen2' mutations
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCfB3035
- Backbone size w/o insert (bp) 4405
-
Vector typeYeast Expression ; integration vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameluxR (gen3 mutations)
-
SpeciesVibrio fischeri
-
Insert Size (bp)1125
-
MutationGal4_AD: F51 (TTC→TTT), G88E. LuxR: K53E, N86Y, I119V
- Promoter pPGK1
-
Tags
/ Fusion Proteins
- Gal4 activation domain
- nuclear localization signal
Cloning Information
- Cloning method Other
- 5′ sequencing primer gtacaggatacgctaattgc
- 3′ sequencing primer acacgcctgttacttcttgc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal coding sequence of luxR was derived from Addgene plasmid #165971, which we fused with Gal4_AD and subjected to mutagenesis and selected this variant.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-6620198/v1 for Research Square preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAvA143 was a gift from Emil Jensen (Addgene plasmid # 248147 ; http://n2t.net/addgene:248147 ; RRID:Addgene_248147) -
For your References section:
Engineering N-acyl-homoserine lactone-based quorum-sensing circuit for dynamic regulatory control in Saccharomyces cerevisiae. van Aalst ACA, Holtz M, Lyskjaer Jensen M, Schroder T, Crocoll C, Poborsky M, Damgaard Jensen E, Krogh Jensen M. Commun Biol. 2025 Nov 27. doi: 10.1038/s42003-025-09163-9. 10.1038/s42003-025-09163-9 PubMed 41310402