pAAV-hSyn-Gluc-feRMA-IRES-EGFP
(Plasmid
#248190)
-
PurposeExpresses Gluc-feRMA and EGFP under the hSyn promoter. Gluc-feRMA enables monitoring of neuronal transduction and includes a TEV cs, allowing inactivation of it upon interaction with TEV protease.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4569
- Total vector size (bp) 7153
-
Vector typeMammalian Expression, AAV ; luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameGaussia luciferase with TEV cleavage site fused to IgG1 Fc
-
Alt nameGluc-feRMA
-
SpeciesM. musculus (mouse), Synthetic; Gaussia princeps
-
Insert Size (bp)1233
- Promoter hSyn
-
Tags
/ Fusion Proteins
- Gluc (N terminal on insert) (N terminal on insert)
- IgG1 Fc (C terminal on insert) (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tcagcgctgcctcagtct
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIRES-EGFP
-
Insert Size (bp)587
- Promoter IRES
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gtatgggatctgatctggggc
- 3′ sequencing primer gtatgggatctgatctggggc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was made by inserting a TEV cleavage site in pAAV-hSyn-Gluc-RMA-IRES-EGFP (Plasmid #189629).
Please visit https://doi.org/10.1101/2025.05.08.652140 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-Gluc-feRMA-IRES-EGFP was a gift from Jerzy Szablowski (Addgene plasmid # 248190 ; http://n2t.net/addgene:248190 ; RRID:Addgene_248190) -
For your References section:
Erasable Serum Markers. Nouraein S, Lee S, Li H, Saenz VA, Raisely EK, Costa VP, Szablowski JO. bioRxiv 2025.05.08.652140 10.1101/2025.05.08.652140