pAAV-hSyn-Gluc-feRMA-IRES-EGFP
(Plasmid #248190)

• Purpose: Expresses Gluc-feRMA and EGFP under the hSyn promoter. Gluc-feRMA enables monitoring of neuronal transduction and includes a TEV cs, allowing inactivation of it upon interaction with TEV protease.
• Depositing Lab: Jerzy Szablowski
• Publication: Nouraein et al bioRxiv 2025.05.08.652140

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4569
• Total vector size (bp): 7153
• Vector type: Mammalian Expression, AAV ; luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Gaussia luciferase with TEV cleavage site fused to IgG1 Fc
• Alt name: Gluc-feRMA
• Species: M. musculus (mouse), Synthetic; Gaussia princeps
• Insert Size (bp): 1233
• Promoter: hSyn
• Tags / Fusion Proteins:
  • Gluc (N terminal on insert) (N terminal on insert)
  • IgG1 Fc (C terminal on insert) (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcagcgctgcctcagtct

Gene/Insert 2

• Gene/Insert name: IRES-EGFP
• Insert Size (bp): 587
• Promoter: IRES

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtatgggatctgatctggggc
• 3′ sequencing primer: gtatgggatctgatctggggc

Resource Information

• Supplemental Documents:
  • ferma_paav-hsyn-glucm23-mouse-igg1-fc-ires-egfp-added-wpre_rev-annotation.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was made by inserting a TEV cleavage site in pAAV-hSyn-Gluc-RMA-IRES-EGFP (Plasmid #189629).

Please visit https://doi.org/10.1101/2025.05.08.652140 for bioRxiv preprint.