pcDNA3-Arl13b-PR-EGFP-TurboID
(Plasmid
#248196)
-
PurposeMammalian expression of truncated Arl13b containing the Proline-Rich domain at the C-terminus (cytosol localization).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5382
- Total vector size (bp) 7308
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThe Arl13b noncilium targeting sequence-EGFP-TurboID
-
Alt nameArl13b nonCTS- EGFP-TurboID
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1926
-
MutationTruncated to only contain the PR domain
-
Entrez GeneArl13b (a.k.a. A530097K21Rik, A930014M17Rik, Arl2l1, C530009C10Rik, hnn)
- Promoter CMV
-
Tags
/ Fusion Proteins
- EGFP (C terminal on insert)
- TurboID (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-Arl13b-PR-EGFP-TurboID was a gift from Xuecai Ge (Addgene plasmid # 248196 ; http://n2t.net/addgene:248196 ; RRID:Addgene_248196) -
For your References section:
Numb positively regulates Hedgehog signaling at the ciliary pocket. Liu X, Yam PT, Schlienger S, Cai E, Zhang J, Chen WJ, Torres Gutierrez O, Jimenez Amilburu V, Ramamurthy V, Ting AY, Branon TC, Cayouette M, Gen R, Marks T, Kong JH, Charron F, Ge X. Nat Commun. 2024 Apr 25;15(1):3365. doi: 10.1038/s41467-024-47244-1. 10.1038/s41467-024-47244-1 PubMed 38664376