pET21a-irisin
(Plasmid
#248349)
-
PurposeExpression of irisin protein in prokaryotic expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLow temperature expression of proteins in BL21
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameirisin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)309
-
Entrez GeneFNDC5 (a.k.a. FRCP2, irisin)
-
Tag
/ Fusion Protein
- His
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21a-irisin was a gift from Yanjun Dong (Addgene plasmid # 248349 ; http://n2t.net/addgene:248349 ; RRID:Addgene_248349) -
For your References section:
Irisin regulates the phosphorylation of glucocorticoid receptor Ser212 and Ser234 and mediates glucocorticoid-induced muscle atrophy in mice. Yang J, Zhang P, An Y, Tan S, Sun S, Liu Y, Zhu L, Wang H, Gao T, Dong Y. Commun Biol. 2025 Dec 4;8(1):1746. doi: 10.1038/s42003-025-09203-4. 10.1038/s42003-025-09203-4 PubMed 41345463