pLenti-gRNA1-4
(Plasmid
#248523)
-
PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeres
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiGuide-Puro-FE
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA1-4
-
gRNA/shRNA sequenceTTCTACCATTGACCTCAAAG
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-gRNA1-4 was a gift from Teresa Davoli (Addgene plasmid # 248523 ; http://n2t.net/addgene:248523 ; RRID:Addgene_248523) -
For your References section:
KaryoCreate: A CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeres. Bosco N, Goldberg A, Zhao X, Mays JC, Cheng P, Johnson AF, Bianchi JJ, Toscani C, Di Tommaso E, Katsnelson L, Annuar D, Mei S, Faitelson RE, Pesselev IY, Mohamed KS, Mermerian A, Camacho-Hernandez EM, Gionco CA, Manikas J, Tseng YS, Sun Z, Fani S, Keegan S, Lippman SM, Fenyo D, Giunta S, Santaguida S, Davoli T. Cell. 2023 Apr 27;186(9):1985-2001.e19. doi: 10.1016/j.cell.2023.03.029. Epub 2023 Apr 18. 10.1016/j.cell.2023.03.029 PubMed 37075754