Skip to main content

pLenti-gRNA3-1
(Plasmid #248526)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248526 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiGuide-Puro-FE
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA3-1
  • gRNA/shRNA sequence
    TTCCAATCTGCTCCGCCTAA
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-gRNA3-1 was a gift from Teresa Davoli (Addgene plasmid # 248526 ; http://n2t.net/addgene:248526 ; RRID:Addgene_248526)
  • For your References section:

    KaryoCreate: A CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeres. Bosco N, Goldberg A, Zhao X, Mays JC, Cheng P, Johnson AF, Bianchi JJ, Toscani C, Di Tommaso E, Katsnelson L, Annuar D, Mei S, Faitelson RE, Pesselev IY, Mohamed KS, Mermerian A, Camacho-Hernandez EM, Gionco CA, Manikas J, Tseng YS, Sun Z, Fani S, Keegan S, Lippman SM, Fenyo D, Giunta S, Santaguida S, Davoli T. Cell. 2023 Apr 27;186(9):1985-2001.e19. doi: 10.1016/j.cell.2023.03.029. Epub 2023 Apr 18. 10.1016/j.cell.2023.03.029 PubMed 37075754