GST-tag LUBAC binding E2 variant D3LU-2
(Plasmid
#248591)
-
PurposeN-term GST tag E2 variant selected for LUBAC
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepGEX-GST-D3LU-2
-
SpeciesSynthetic
-
Insert Size (bp)465
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAGCAAGTATATAGCATGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GST-tag LUBAC binding E2 variant D3LU-2 was a gift from Brenda Schulman (Addgene plasmid # 248591 ; http://n2t.net/addgene:248591 ; RRID:Addgene_248591) -
For your References section:
E2 variants for probing E3 ubiquitin ligase activities. Du J, Andree GA, Horn-Ghetko D, Stier L, Singh J, Kostrhon S, Kiss L, Mann M, Sidhu SS, Schulman BA. Proc Natl Acad Sci U S A. 2026 Jan 6;123(1):e2524899122. doi: 10.1073/pnas.2524899122. Epub 2026 Jan 2. 10.1073/pnas.2524899122 PubMed 41481455