pJB127
(Plasmid
#248630)
-
PurposeTheophylline-based control of repA on a C. difficile plasmid for use in allelic exchange and codA added to help cure strains of the plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248630 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJB94
-
Backbone manufacturerJoseph Sorg, Addgene plasmid #208752
- Total vector size (bp) 8768
-
Vector typeOther
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namesacB
-
Alt namelevansucrase
-
Insert Size (bp)1422
-
Entrez GenesacB (a.k.a. BSU_34450, BSU34450)
Gene/Insert 2
-
Gene/Insert namecodA
-
Alt namecytosine deaminase
-
SpeciesE. coli
-
Insert Size (bp)1284
-
GenBank IDCP184745.1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcccggatcgagatagtatatgatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB127 was a gift from Joseph Sorg (Addgene plasmid # 248630 ; http://n2t.net/addgene:248630 ; RRID:Addgene_248630) -
For your References section:
Theophylline-based control of repA on a Clostridioides difficile plasmid for use in allelic exchange. Brehm JN, Sorg JA. Anaerobe. 2024 Apr 29;88:102858. doi: 10.1016/j.anaerobe.2024.102858. 10.1016/j.anaerobe.2024.102858 PubMed 38692475