pBIG1A_eIF2abg
(Plasmid #248659)

• Purpose: Express the three subunits of human eIF2 in insect cells to purify the complex
• Depositing Lab: Venki Ramakrishnan
• Publication: Diaz-Lopez et al Protein Sci. 2026 Jan;35(1):e70388. doi: 10.1002/pro.70388.

Backbone

• Vector backbone: pBIG1x
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: eIF2 alpha
• Alt name: eIF2S1
• Species: H. sapiens (human)
• Insert Size (bp): 945
• Entrez Gene: EIF2S1 (a.k.a. EIF-2, EIF-2A, EIF-2alpha, EIF2, EIF2A)
• Promoter: Polyhedrin

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGCCGGGTCTAAGTTGTAG

Gene/Insert 2

• Gene/Insert name: eIF2 beta
• Alt name: eIF2S2
• Species: H. sapiens (human)
• Insert Size (bp): 994
• Entrez Gene: EIF2S2 (a.k.a. EIF2, EIF2B, EIF2beta, PPP1R67, eIF-2-beta)
• Promoter: Polyhedrin

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGTCTGGGGACGAGATGATTTTTG

Gene/Insert 3

• Gene/Insert name: eIF2 gamma
• Alt name: eIF2S3
• Species: H. sapiens (human)
• Entrez Gene: EIF2S3 (a.k.a. EIF2, EIF2G, EIF2gamma, MEHMO, MRXSBRK, eIF-2gA, eIF2gX)
• Promoter: Polyhedrin
• Tag / Fusion Protein:
  • Twin strep tag (C terminal on insert)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGGCGGGCGGAGAAGCTGGAGTG

Resource Information

• Supplemental Documents:
  • pBIG1_eIF2.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry