pSpyB-Tn7sg
(Plasmid
#248694)
-
PurposesgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSEVA231
-
Backbone manufacturerSEVA
- Backbone size w/o insert (bp) 3272
- Total vector size (bp) 3292
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTn7sg
-
gRNA/shRNA sequenceGTATGCTTTTTCACAGCATA
-
SpeciesSynthetic
- Promoter BG35
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer PS-1: AGGGCGGCGGATTTGTCC
- 3′ sequencing primer PS-2: GCGGCAACCGAGCGTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpyB-Tn7sg was a gift from Larry Halverson (Addgene plasmid # 248694 ; http://n2t.net/addgene:248694 ; RRID:Addgene_248694) -
For your References section:
Optimized CRISPR Interference System for Investigating Pseudomonas alloputida Genes Involved in Rhizosphere Microbiome Assembly. Roghair Stroud MN, Vang DX, Halverson LJ. ACS Synth Biol. 2024 Aug 20. doi: 10.1021/acssynbio.4c00312. 10.1021/acssynbio.4c00312 PubMed 39163848