pCMV-b-catenin(mouse)-3HA
(Plasmid
#248783)
-
PurposeExpress mouse b-catenin in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 6021
- Total vector size (bp) 8364
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameb-catenin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2343
-
Entrez GeneCtnnb1 (a.k.a. Bfc, Catnb, Mesc)
- Promoter pCMV
-
Tag
/ Fusion Protein
- 3HA (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTGGCACCAAAATCAACGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-b-catenin(mouse)-3HA was a gift from Wenyan Ren (Addgene plasmid # 248783 ; http://n2t.net/addgene:248783 ; RRID:Addgene_248783) -
For your References section:
Integrative analysis reveals synergistic regulation of Sp7 by BRD9 and Wnt/beta-catenin signaling during osteogenic differentiation. Wu L, Wang L, Zhuang Y, Luo Y, Zhu Q, Maimaitizunong M, Wang Y, Cheng Z, Li Y, Sheng X, Li M, Luo Q, Jiang X, Lei S, Lin X, Zhong Y, Ren W. Commun Biol. 2025 Dec 1. doi: 10.1038/s42003-025-09278-z. 10.1038/s42003-025-09278-z PubMed 41326797