Skip to main content

Tet-pLKO-puro-shSF3B1
(Plasmid #248800)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248800 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone manufacturer
    Dmitri Wiederschain (Addgene #21915)
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA targeting SF3B1 3'UTR
  • gRNA/shRNA sequence
    CCGGTGCTTTGATTTGGTGATGTAACTCGAGTTACATCACCAAATCAAAGCATTTTTG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    57
  • Promoter hPGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer tgtcgctatgtgttctggga
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The sequence of shSF3B1: Huang, Y. et al. (2018). SF3B1 deficiency impairs human erythropoiesis via activation of p53 pathway: implications for understanding of ineffective erythropoiesis in MDS. Journal of Hematology & Oncology, 11(1), 19. https://doi.org/10.1186/s13045-018-0558-8.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.05.08.652831 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tet-pLKO-puro-shSF3B1 was a gift from Maayan Salton (Addgene plasmid # 248800 ; http://n2t.net/addgene:248800 ; RRID:Addgene_248800)
  • For your References section:

    SF3B1K700E rewires splicing of cell-cycle regulators. Baker M, Engel E, Sharma A, Patesny M, Jaffe S, Geminder O, Su MH, Bentata M, Gershon A, Kay G, Salton M. RNA. 2025 Dec 24:rna.080661.125. doi: 10.1261/rna.080661.125. 10.1261/rna.080661.125 PubMed 41443830