Tet-pLKO-puro-shSF3B1
(Plasmid
#248800)
-
PurposeKnockdown of endogenous SF3B1 with shRNA targeting 3'UTR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTet-pLKO-puro
-
Backbone manufacturerDmitri Wiederschain (Addgene #21915)
- Backbone size w/o insert (bp) 7032
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA targeting SF3B1 3'UTR
-
gRNA/shRNA sequenceCCGGTGCTTTGATTTGGTGATGTAACTCGAGTTACATCACCAAATCAAAGCATTTTTG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)57
- Promoter hPGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer tgtcgctatgtgttctggga
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe sequence of shSF3B1: Huang, Y. et al. (2018). SF3B1 deficiency impairs human erythropoiesis via activation of p53 pathway: implications for understanding of ineffective erythropoiesis in MDS. Journal of Hematology & Oncology, 11(1), 19. https://doi.org/10.1186/s13045-018-0558-8.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.08.652831 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tet-pLKO-puro-shSF3B1 was a gift from Maayan Salton (Addgene plasmid # 248800 ; http://n2t.net/addgene:248800 ; RRID:Addgene_248800) -
For your References section:
SF3B1K700E rewires splicing of cell-cycle regulators. Baker M, Engel E, Sharma A, Patesny M, Jaffe S, Geminder O, Su MH, Bentata M, Gershon A, Kay G, Salton M. RNA. 2025 Dec 24:rna.080661.125. doi: 10.1261/rna.080661.125. 10.1261/rna.080661.125 PubMed 41443830