Skip to main content
Addgene
Open Menu

DDT Wnt
(Plasmid #248843)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248843 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    7TGC (Addgene plasmid #24304)
  • Vector type
    Lentiviral
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    To replace the TCF7 binding element with other pathway-specific response elements, propagate the DDT Wnt plasmid in the JM110 strain, which lacks Dam and Dcm methylases.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    7xTCF binding element
  • Promoter 7xTCF binding element & minimal TATA-box promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer gaaggtggagagagagacagagacag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DDT Wnt was a gift from Hai Jiang (Addgene plasmid # 248843 ; http://n2t.net/addgene:248843 ; RRID:Addgene_248843)

  • For your References section:

    STT3A is essential for Wnt signaling and represents a target for cancers driven by RNF43 deficiency. He Z, Chen S, Suo J, Xia K, Liu M, Ma J, Chu Y, Wang C, Xie Y, Jiang W, Du H, Chen S, Zhou Z, Li M, Wei Q, Zhao Y, Chen J, Li L, Zeng Y, Zou W, Lin M, Jiang H. Cell Chem Biol. 2025 Oct 22:S2451-9456(25)00306-X. doi: 10.1016/j.chembiol.2025.10.001. 10.1016/j.chembiol.2025.10.001 PubMed 41130209
Related items: