DDT Wnt
(Plasmid
#248843)
-
PurposeDouble Death Trap (DDT) Wnt reporter Containing FKBP12(F36V)-ΔCaspase9 (FC) and Puromycin Resistance Gene for Assessing Wnt Signaling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbone7TGC (Addgene plasmid #24304)
-
Vector typeLentiviral
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsTo replace the TCF7 binding element with other pathway-specific response elements, propagate the DDT Wnt plasmid in the JM110 strain, which lacks Dam and Dcm methylases.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name7xTCF binding element
- Promoter 7xTCF binding element & minimal TATA-box promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer gaaggtggagagagagacagagacag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DDT Wnt was a gift from Hai Jiang (Addgene plasmid # 248843 ; http://n2t.net/addgene:248843 ; RRID:Addgene_248843) -
For your References section:
STT3A is essential for Wnt signaling and represents a target for cancers driven by RNF43 deficiency. He Z, Chen S, Suo J, Xia K, Liu M, Ma J, Chu Y, Wang C, Xie Y, Jiang W, Du H, Chen S, Zhou Z, Li M, Wei Q, Zhao Y, Chen J, Li L, Zeng Y, Zou W, Lin M, Jiang H. Cell Chem Biol. 2025 Oct 22:S2451-9456(25)00306-X. doi: 10.1016/j.chembiol.2025.10.001. 10.1016/j.chembiol.2025.10.001 PubMed 41130209