pRS316-pTEF-Sc_IntAct-tCYC
(Plasmid
#248980)
-
PurposeLow-copy centromeric plasmids which expresses Saccharomyces cerevisiae IntAct (actin internally tagged with ALFA tag between T229 and A230 amino acids)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS316-Ptef-MCS-terCYC
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSc_IntAct
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1173
-
GenBank IDNM_001179927.1 NP_116614.1
- Promoter TEF
-
Tag
/ Fusion Protein
- ALFA tag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGTCTTCAATTTCTCAAGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS316-pTEF-Sc_IntAct-tCYC was a gift from Saravanan Palani (Addgene plasmid # 248980 ; http://n2t.net/addgene:248980 ; RRID:Addgene_248980) -
For your References section:
IntAct: A nondisruptive internal tagging strategy to study the organization and function of actin isoforms. van Zwam MC, Dhar A, Bosman W, van Straaten W, Weijers S, Seta E, Joosten B, van Haren J, Palani S, van den Dries K. PLoS Biol. 2024 Mar 11;22(3):e3002551. doi: 10.1371/journal.pbio.3002551. eCollection 2024 Mar. 10.1371/journal.pbio.3002551 PubMed 38466773