pKlab965-PX459-BRCA1-Nterm-guide1
(Plasmid
#249005)
-
PurposeThis plasmid expresses the Cas9/gRNA that will target the HBEGF gene locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepVAX1
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
gRNA/shRNA sequenceTTCATTGGAACAGAAAGAAA
-
SpeciesH. sapiens (human)
- Promoter chicken beta-actin promoter
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Second insert: gRNA followed by gRNA scaffold
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKlab965-PX459-BRCA1-Nterm-guide1 was a gift from Georgios Karras (Addgene plasmid # 249005 ; http://n2t.net/addgene:249005 ; RRID:Addgene_249005) -
For your References section:
HSP90 buffers deleterious genetic variations in BRCA1. Gracia B, Zhang XH, Montes P, Pham TC, Huang M, Chen J, Karras GI. Mol Cell. 2025 Nov 19:S1097-2765(25)00867-6. doi: 10.1016/j.molcel.2025.10.026. 10.1016/j.molcel.2025.10.026 PubMed 41265458