pscAAV-U6-gThy1-CBh-mCherry-SV40late
(Plasmid
#249126)
-
Purposeexpression of gThy1 and mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepscAAV-CAG-GFP
- Backbone size w/o insert (bp) 2955
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegThy1
-
gRNA/shRNA sequenceGCTGGTCACCTTCTGCCCTC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2047
-
Entrez GeneThy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)
- Promoter hU6
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
contains CBh-driven mCherry for assessing transient transduction efficiency
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pscAAV-U6-gThy1-CBh-mCherry-SV40late was a gift from Matthew Krummel (Addgene plasmid # 249126 ; http://n2t.net/addgene:249126 ; RRID:Addgene_249126) -
For your References section:
Local gene editing of fibroblasts in tumors reveals a new cancer-associated fibroblast state. Kuhn NF, Zaleta-Linares I, Hu KH, Courau T, Davidson B, Tam T, Chu CW, Kinet MJ, Rosenblum MD, Combes AJ, Nyberg WA, Eyquem J, Krummel MF. J Exp Med. 2026 May 4;223(5):e20251228. doi: 10.1084/jem.20251228. Epub 2026 Mar 25. 10.1084/jem.20251228 PubMed 41879666