Skip to main content

pscAAV-KIKO-U6-gThy1-p2a-mCherry-STOP-pA-400
(Plasmid #249129)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249129 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pscAAV-CAG-GFP
  • Backbone size w/o insert (bp) 2955
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    gThy1, mCherry
  • gRNA/shRNA sequence
    GCTGGTCACCTTCTGCCCTC
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    2062
  • Entrez Gene
    Thy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gThy1 cuts in Exon 3 of Thy1; contains left (400 bp) and right (380 bp) homology arms relative to cut site to facilitate in-frame knock-in of p2a-mCherry

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pscAAV-KIKO-U6-gThy1-p2a-mCherry-STOP-pA-400 was a gift from Matthew Krummel (Addgene plasmid # 249129 ; http://n2t.net/addgene:249129 ; RRID:Addgene_249129)
  • For your References section:

    Local gene editing of fibroblasts in tumors reveals a new cancer-associated fibroblast state. Kuhn NF, Zaleta-Linares I, Hu KH, Courau T, Davidson B, Tam T, Chu CW, Kinet MJ, Rosenblum MD, Combes AJ, Nyberg WA, Eyquem J, Krummel MF. J Exp Med. 2026 May 4;223(5):e20251228. doi: 10.1084/jem.20251228. Epub 2026 Mar 25. 10.1084/jem.20251228 PubMed 41879666