pHoY110_pAC8_hsDCAF5_FL
(Plasmid
#249183)
-
PurposeExpress DCAF5(full length) in Insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAC8
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDCAF5 full length
-
Alt nameDDB1- and CUL4-associated factor 5
-
Alt nameBCRG2, KIAA1824, WDR22
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2961
-
MutationN/A
-
Entrez GeneDCAF5 (a.k.a. BCRG2, BCRP2, D14S1461E, WDR22)
-
Tag
/ Fusion Protein
- Strep_BirA_short-linker-TEV (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATAACCATCTCGCAAATAAATAAGTATTTTACTG
- 3′ sequencing primer AATTGTCTGTAAATCAACAACGCACAGAATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHoY110_pAC8_hsDCAF5_FL was a gift from Eric Fischer (Addgene plasmid # 249183 ; http://n2t.net/addgene:249183 ; RRID:Addgene_249183) -
For your References section:
Targeting DCAF5 suppresses SMARCB1-mutant cancer by stabilizing SWI/SNF. Radko-Juettner S, Yue H, Myers JA, Carter RD, Robertson AN, Mittal P, Zhu Z, Hansen BS, Donovan KA, Hunkeler M, Rosikiewicz W, Wu Z, McReynolds MG, Roy Burman SS, Schmoker AM, Mageed N, Brown SA, Mobley RJ, Partridge JF, Stewart EA, Pruett-Miller SM, Nabet B, Peng J, Gray NS, Fischer ES, Roberts CWM. Nature. 2024 Apr;628(8007):442-449. doi: 10.1038/s41586-024-07250-1. Epub 2024 Mar 27. 10.1038/s41586-024-07250-1 PubMed 38538798