Skip to main content

pCEFL_GPR161-HA
(Plasmid #249268)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249268 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCEFL
  • Backbone manufacturer
    Addgene #38121
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPR161
  • Alt name
    GPR161-HA, codon optimized
  • Species
    H. sapiens (human)
  • Entrez Gene
    GPR161 (a.k.a. RE2)
  • Promoter EF-1
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
  • 3′ sequencing primer SP6
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCEFL_GPR161-HA was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 249268 ; http://n2t.net/addgene:249268 ; RRID:Addgene_249268)
  • For your References section:

    Dissection of Galphas and Hedgehog Signaling Crosstalk Reveals Therapeutic Opportunities to Target Hedgehog-Dependent Tumors. Krantz S, Bell BA, Lund K, Salinas Parra N, Ng Y, De Oliveira Rosa N, Mukhopadhyay S, St Croix B, Sarin KY, Weigert R, Raimondi F, Iglesias-Bartolome R. Cancer Res. 2025 Dec 29. doi: 10.1158/0008-5472.CAN-25-1109. 10.1158/0008-5472.CAN-25-1109 PubMed 41460725