pCEFL PRKACA HA E128K
(Plasmid
#249273)
-
PurposeExpression of PKA T128K mutant (PRKACAE128K)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCEFL
-
Backbone manufacturerAddgene #38121
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRKACA
-
Alt nameProtein kinase A (PKA), codon optimized, E128K mutation, HA tag
-
SpeciesH. sapiens (human)
-
MutationE128K
-
GenBank IDNM_002730
-
Entrez GenePRKACA (a.k.a. CAFD1, PKACA, PPNAD4)
- Promoter EF-1
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
- 3′ sequencing primer SP6
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2025.02.21.639530v1 for bioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEFL PRKACA HA E128K was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 249273 ; http://n2t.net/addgene:249273 ; RRID:Addgene_249273) -
For your References section:
Dissection of Galphas and Hedgehog Signaling Crosstalk Reveals Therapeutic Opportunities to Target Hedgehog-Dependent Tumors. Krantz S, Bell BA, Lund K, Salinas Parra N, Ng Y, De Oliveira Rosa N, Mukhopadhyay S, St Croix B, Sarin KY, Weigert R, Raimondi F, Iglesias-Bartolome R. Cancer Res. 2025 Dec 29. doi: 10.1158/0008-5472.CAN-25-1109. 10.1158/0008-5472.CAN-25-1109 PubMed 41460725