Skip to main content

pCEFL GNAS EE WT
(Plasmid #249276)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249276 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCEFL
  • Backbone manufacturer
    Addgene #38121
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GNAS
  • Alt name
    Human G-protein alpha s long subunit, codon optimized, wild type, Internal EE-tag
  • Species
    H. sapiens (human)
  • Mutation
    Internal EE-tag
  • Entrez Gene
    GNAS (a.k.a. AHO, AIMAH1, C20orf45, GNAS1, GPSA, GSA, GSP, NESP, PITA3, POH, SCG6, SgVI)
  • Promoter EF-1
  • Tag / Fusion Protein
    • Internal EE tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
  • 3′ sequencing primer SP6
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCEFL GNAS EE WT was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 249276 ; http://n2t.net/addgene:249276 ; RRID:Addgene_249276)
  • For your References section:

    Dissection of Galphas and Hedgehog Signaling Crosstalk Reveals Therapeutic Opportunities to Target Hedgehog-Dependent Tumors. Krantz S, Bell BA, Lund K, Salinas Parra N, Ng Y, De Oliveira Rosa N, Mukhopadhyay S, St Croix B, Sarin KY, Weigert R, Raimondi F, Iglesias-Bartolome R. Cancer Res. 2025 Dec 29. doi: 10.1158/0008-5472.CAN-25-1109. 10.1158/0008-5472.CAN-25-1109 PubMed 41460725