pCEFL GNAS EE K32R
(Plasmid
#249277)
-
PurposeExpression of Galphas K32R mutant (GNASK32R) EE-tagged (internal)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCEFL
-
Backbone manufacturerAddgene #38121
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGNAS
-
Alt nameHuman G-protein alpha s long subunit, codon optimized, K32R mutation, Internal EE-tag
-
SpeciesH. sapiens (human)
-
MutationGNAS-K32R Internal EE-tag
-
Entrez GeneGNAS (a.k.a. AHO, AIMAH1, C20orf45, GNAS1, GPSA, GSA, GSP, NESP, PITA3, POH, SCG6, SgVI)
- Promoter EF-1
-
Tag
/ Fusion Protein
- Internal EE tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
- 3′ sequencing primer SP6
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2025.02.21.639530v1 for bioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEFL GNAS EE K32R was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 249277 ; http://n2t.net/addgene:249277 ; RRID:Addgene_249277) -
For your References section:
Dissection of Galphas and Hedgehog Signaling Crosstalk Reveals Therapeutic Opportunities to Target Hedgehog-Dependent Tumors. Krantz S, Bell BA, Lund K, Salinas Parra N, Ng Y, De Oliveira Rosa N, Mukhopadhyay S, St Croix B, Sarin KY, Weigert R, Raimondi F, Iglesias-Bartolome R. Cancer Res. 2025 Dec 29. doi: 10.1158/0008-5472.CAN-25-1109. 10.1158/0008-5472.CAN-25-1109 PubMed 41460725