pAAV-hSyn-dTomato-Fb(LAG16)-RiboL1
(Plasmid
#249315)
-
PurposedTomato-Fb(LAG16) expression in mammalian cells. pAAV vector.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV
-
Backbone manufacturerAddgene #169247
- Backbone size w/o insert (bp) 5309
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedTomato-Fb(LAG16)
-
SpeciesSynthetic
-
Insert Size (bp)1104
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
- 3′ sequencing primer cagcgtatccacatagcgtaaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTo make pAAV-hSyn-dTomato-Fb(LAG16)-RiboL1, dTomato-Fb(LAG16) was amplified and swapped with jGCaMP8s in the pAAV-hSyn-RiboL1-jGCaMP8s (Addgene #169247).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-dTomato-Fb(LAG16)-RiboL1 was a gift from Vladislav Verkhusha (Addgene plasmid # 249315 ; http://n2t.net/addgene:249315 ; RRID:Addgene_249315) -
For your References section:
Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labeling and functional imaging. Barykina NV, Carey EM, Oliinyk OS, Mendonça-Gomes JM, de Oliveira S, Nimmerjahn A, Verkhusha VV. Nat Methods, 2026 10.1038/s41592-026-03056-3