pCBS-5740
(Plasmid
#249327)
-
PurposeExpresses sgRNA targeting the fcy gene in S. cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting fcy
-
gRNA/shRNA sequenceTAATCTCCCACAGTTTTCCA
-
SpeciesSynthetic
-
MutationN/A
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCBS-5740 was a gift from Chase Beisel (Addgene plasmid # 249327 ; http://n2t.net/addgene:249327 ; RRID:Addgene_249327) -
For your References section:
Targeted DNA ADP-ribosylation triggers templated repair in bacteria and base mutagenesis in eukaryotes. Gupta D, Patinios C, Bassett HV, Kibe A, Collins SP, Kamm C, Wang Y, Zhao C, Vollen K, Toussaint C, Calvin I, Cullot G, Aird EJ, Polkoff KM, Nguyen-Vo TP, Migur A, Schut F, Al'Abri IS, Achmedov T, Del Re A, Corn JE, Saliba AE, Crook N, Stepanova AN, Alonso JM, Beisel CL. Nat Biotechnol. 2025 Sep 4. doi: 10.1038/s41587-025-02802-w. 10.1038/s41587-025-02802-w PubMed 40908325