Skip to main content

pCBS-5846
(Plasmid #249329)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249329 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EPEC DarT2(G49D)-nSpCas9(D10A)
  • gRNA/shRNA sequence
    AAGCTTTCCACCATCAACAC
  • Species
    Synthetic
  • Mutation
    DarT2(G49D) and nSpCas9(D10A)
  • Tag / Fusion Protein
    • 3X Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Golden Gate

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCBS-5846 was a gift from Chase Beisel (Addgene plasmid # 249329 ; http://n2t.net/addgene:249329 ; RRID:Addgene_249329)
  • For your References section:

    Targeted DNA ADP-ribosylation triggers templated repair in bacteria and base mutagenesis in eukaryotes. Gupta D, Patinios C, Bassett HV, Kibe A, Collins SP, Kamm C, Wang Y, Zhao C, Vollen K, Toussaint C, Calvin I, Cullot G, Aird EJ, Polkoff KM, Nguyen-Vo TP, Migur A, Schut F, Al'Abri IS, Achmedov T, Del Re A, Corn JE, Saliba AE, Crook N, Stepanova AN, Alonso JM, Beisel CL. Nat Biotechnol. 2025 Sep 4. doi: 10.1038/s41587-025-02802-w. 10.1038/s41587-025-02802-w PubMed 40908325