pClgn1.1-mouse Tmem217-3xFlag
(Plasmid
#249335)
-
PurposeExpression vector of mouse Tmem217 tagged with 3xFLAG at C-terminus under the mouse Clgn promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249335 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepClgn1.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTransmembrane protein 217
-
Alt nameTmem217
-
SpeciesM. musculus (mouse)
-
Entrez GeneTmem217 (a.k.a. 4933413N12Rik, EG622644)
- Promoter Calmegin
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTGAGCGGGCCGCTTGCGCACTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pClgn1.1-mouse Tmem217-3xFlag was a gift from Masahito Ikawa (Addgene plasmid # 249335 ; http://n2t.net/addgene:249335 ; RRID:Addgene_249335) -
For your References section:
Formation of a complex between TMEM217 and the sodium-proton exchanger SLC9C1 is crucial for mouse sperm motility and male fertility. Iida-Norita R, Miyata H, Ninomiya A, Emori C, Kamoshita M, Pan C, Wang H, Ikawa M. Proc Natl Acad Sci U S A. 2025 Oct 21;122(42):e2513924122. doi: 10.1073/pnas.2513924122. Epub 2025 Oct 15. 10.1073/pnas.2513924122 PubMed 41091759