pMX H2B-mKate2
(Plasmid
#249336)
-
PurposeFluorescence nuclear marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMX
- Backbone size w/o insert (bp) 4529
- Total vector size (bp) 5612
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHistone 2B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)378
-
Tag
/ Fusion Protein
- mKate2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer caaagtagacggcatcgcagc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX H2B-mKate2 was a gift from Takeaki Ozawa (Addgene plasmid # 249336 ; http://n2t.net/addgene:249336 ; RRID:Addgene_249336) -
For your References section:
Immediate nuclear accumulation of BMAL1 to regulate cellular circadian clock synchronization. Tamaru T, Kawamura G, Yoshitane H, Koinuma S, Fukada Y, Naito A, Ozawa T, Takamatsu K. Commun Biol. 2025 Dec 17. doi: 10.1038/s42003-025-09373-1. 10.1038/s42003-025-09373-1 PubMed 41408449