Skip to main content

pMX Bmal1pomoter mVenus-linkerB-BMAL1
(Plasmid #249338)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249338 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMX
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 7693
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BMAL1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1881
  • Entrez Gene
    Bmal1 (a.k.a. Arnt3, Arntl, BMAL1b, MOP3, bHLHe5, bmal1b')
  • Promoter Bmal1 promoter
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer caaagtagacggcatcgcagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMX Bmal1pomoter mVenus-linkerB-BMAL1 was a gift from Takeaki Ozawa (Addgene plasmid # 249338 ; http://n2t.net/addgene:249338 ; RRID:Addgene_249338)
  • For your References section:

    Immediate nuclear accumulation of BMAL1 to regulate cellular circadian clock synchronization. Tamaru T, Kawamura G, Yoshitane H, Koinuma S, Fukada Y, Naito A, Ozawa T, Takamatsu K. Commun Biol. 2025 Dec 17. doi: 10.1038/s42003-025-09373-1. 10.1038/s42003-025-09373-1 PubMed 41408449