EBOV Zeo-eGFP minigenome
(Plasmid
#249393)
-
PurposeT7-driven EBOV minigenome vRNA with Zeo-eGFP reporter selection cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 2942
- Total vector size (bp) 5391
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZeocin-eGFP fusion gene flanked by EBOV 5'UTR and 3'UTR
-
Alt nameEBOV Zeo-eGFP minigenome
-
SpeciesEbola virus/H.sapiens-tc/COD/1976/Yambuku-Mayinga
-
Insert Size (bp)2441
-
GenBank IDNC_002549.1 Zaire ebolavirus isolate Ebola virus/H.sapiens-tc/COD/1976/Yambuku-Mayinga, complete genome
- Promoter T7
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer ccgtcgactgcagaggcctgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.09.632058 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EBOV Zeo-eGFP minigenome was a gift from Amy Kistler (Addgene plasmid # 249393 ; http://n2t.net/addgene:249393 ; RRID:Addgene_249393)